Table 1

The sequences of the primers

Primer nameSequence
IRAK1ForwardGTGCTAGAGACCTTGGCTG
ReverseTGTGCTCTGGGTGCTTCTC
TRAF6ForwardATGCGGCCATAGGTTCTGC
ReverseTCCTCAAGATGTCTCAGTTCCAT
  • IRAK1, interleukin-1 receptor-associated kinase 1; TRAF6, tumour necrosis factor receptor-associated factor 6.