Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Interleukin 6 Accelerates Mortality by Promoting the Progression of the Systemic Lupus Erythematosus-Like Disease of BXSB.Yaa Mice

  • Shweta Jain,

    Affiliation Virology and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, MD, United States of America

  • Giljun Park,

    Affiliations The Jackson Laboratory, Bar Harbor, ME, United States of America, Hematology Research Unit, University of Helsinki, Helsinki University Central Hospital Cancer Center, Biomedicum Helsinki 1, Haartmaninkatu, Helsinki, Finland

  • Thomas J. Sproule,

    Affiliation The Jackson Laboratory, Bar Harbor, ME, United States of America

  • Gregory J. Christianson,

    Affiliation The Jackson Laboratory, Bar Harbor, ME, United States of America

  • Caroline M. Leeth,

    Affiliation Department of Animal and Poultry Sciences, College of Agriculture and Life Sciences, Virginia Tech, Blacksburg, VA, United States of America

  • Hongsheng Wang,

    Affiliation Virology and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, MD, United States of America

  • Derry C. Roopenian ,

    hmorse@niaid.nih.gov (HCM); dcr@jax.org (DCR)

    Affiliation The Jackson Laboratory, Bar Harbor, ME, United States of America

  • Herbert C. Morse III

    hmorse@niaid.nih.gov (HCM); dcr@jax.org (DCR)

    Affiliation Virology and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, MD, United States of America

Abstract

IL6 is a multifunctional cytokine that drives terminal B cell differentiation and secretion of immunoglobulins. IL6 also cooperates with IL21 to promote differentiation of CD4+ T follicular helper cells (TFH). Elevated serum levels of IL6 correlate with disease flares in patients with systemic lupus erythematosus (SLE). We previously reported that IL21 produced by TFH plays a critical role in the development of the SLE-like disease of BXSB.Yaa mice. To examine the possible contributions of IL6 to disease, we compared disease parameters in IL6-deficient and IL6-competent BXSB.Yaa mice. We report that survival of IL6-deficient BXSB.Yaa mice was significantly prolonged in association with significant reductions in a variety of autoimmune manifestations. Moreover, B cells stimulated by co-engagement of TLR7 and B cell receptor (BCR) produced high levels of IL6 that was further augmented by stimulation with Type I interferon (IFN1). Importantly, the frequencies of TFH and serum levels of IL21 were significantly reduced in IL6-deficient mice. These findings suggest that high-level production of IL6 by B cells induced by integrated signaling from the IFN1 receptor, TLR7 and BCR promotes the differentiation of IL21-secreting TFH in a signaling sequence that drives the lethal autoimmune disease of BXSB.Yaa mice.

Introduction

Systemic lupus erythematosus (SLE) is a multigenic autoimmune disorder characterized by the formation and accumulation of immune complexes that cause tissue damage. In humans, the disease is more prevalent in females than males. Approximately 40 genes have been identified as genetic susceptibility loci for the disease, revealing the complexity of inheritance that underlies the disorder [1]. Cardinal features of SLE include chronic B cell activation accompanied by the presence of antibodies to a range of self-antigens including anti-nuclear and anti-double stranded DNA antibodies (ANA and dsDNA, respectively). Studies of genetically-programmed mouse models of SLE have advanced our understandings of the mechanisms involved in disease pathogenesis. BXSB.Yaa mice develop a severe humoral autoimmune disease that shares many features with human SLE. Male mice of this strain carry the Y-linked autoimmune accelerator (Yaa) mutation due to the chromosomal translocation of a portion of the X to the Y chromosome resulting in a duplication of a number of genes including Tlr7 [2, 3]. This results in male mice carrying two functional copies of Tlr7 in contrast to BXSB females that express only one functional copy due to X inactivation and BXSB males carrying a wild-type Y-chromosome. The doubling of Tlr7 expression in BXSB.Yaa males is sufficient to greatly accelerate the mild, late onset SLE-like autoimmune disease observed in females after 1 year of age to a much more acute disease with deaths averaging 6 months of age [4, 5]. TLR7 binds single stranded RNA (ssRNA) leading to activation of a signaling cascade that results in the production of Type I IFN (IFN1) and inflammatory cytokines including TNFα and IL6 [68]. In addition, disease flares in human SLE are often associated with heightened expression of IL6 as well as IFN1 that heightens B cell sensitivity to various stimuli.

Previous studies centering on CD4+ T follicular helper cells (TFH) have identified several additional major determinants of disease. First, IL21, a γc cytokine produced primarily by TFH and extrafollicular TFH in BXSB.Yaa mice, is an absolute requirement for disease [9, 10]. This conclusion is based on studies showing that mice deficient in expression of the IL21 receptor (IL21R) exhibited no signs of disease, thereby identifying IL21 as a non-redundant cytokine central to disease initiation and progression [9]. Second, disease progression in BXSB.Yaa mice is restricted by an axis governed by CD8+ T suppressor (Ts) cells and NK cells. These cell populations are also dependent on IL21 as shown by studies demonstrating that the appearance of multiple signs of disease and as well as mortality are greatly accelerated in BXSB.Yaa mice bearing null alleles of both Cd8 and Il15 [10] and that the regulatory activity of CD8 T cells depends on IL21 signaling [11]. Thus, the development of TFH that secrete high levels of IL21 is a central component of the BXSB.Yaa disease.

The mechanisms that drive the expansion of TFH and heightened expression of IL21 by TFH in BXSB.Yaa mice have not been defined. IL6 is an attractive candidate as a promotor of these phenotypes and, more generally, of the pathogenesis of SLE. A number of studies in humans and mice have identified roles for IL6 in conjunction with IL21 in TFH differentiation [1216]. Recently, it was shown that activation of STAT1 by IL6 is critical to the transcriptional activation of Bcl6 and Cxcr5 in the early processes of TFH differentiation with IL21 appearing to contribute to the later phases of the differentiation program [17]. In addition, the established roles of IL6 in late B cell development suggest it may contribute to the massive accumulations of extrafollicular plasmablasts and plasma cells identified in lymphoid tissues of BXSB.Yaa mice [10]. Possible contributions of IL6 to disease in human SLE and in mouse models of lupus were first suggested by the identification of elevated levels of IL6 levels in sera of patients with SLE [1822]. Mouse models of SLE, such as MRL.Faslpr have been found to have increased serum levels of IL6 that progress with age [18, 19]. In addition, IL6 was shown to increase the B cell-mediated autoantibody production in NZB/W F1 mice [23]. Finally, IL6 has been identified as one of the major genetic risk factors for human SLE as determined by genome-wide association studies (GWAS) [24].

The present study was aimed at determining whether IL6 plays an important role in the development of the SLE-like disease of BXSB.Yaa mice. We observed that BXSB.Yaa mice had elevated serum levels of IL6 that correlated with the appearance and progression of disease findings, including the expansion of TFH. We also found that B cells, which exhibited an activated phenotype, were a prominent source of IL6. Remarkably, the survival of BXSB.Yaa mice homozygous for a null allele of Il6 (Il6-/-) was greatly prolonged over that of WT mice, and major signs of disease in younger mice were markedly attenuated.

Materials and Methods

Mice

BXSB.Yaa/MpJ (JR740) mice from the Jackson Laboratory were housed at a NIAID or Jackson Laboratory animal facility. Male and female mice of this strain are designated as BXSB.Yaa and BXSB respectively. IL6-deficient BXSB.Yaa mice (BXSB.YaaIl6-/- or BXSB.Il6+/-) were generated by crossing the IL6 knockout construct from B6.129S2-Il6-/-(B6.129S2-Il6tm1Kopf/J, JR2650) with BXSB.Yaa/MpJ mice for 11 generations. Mice were genotyped for the Il6 knockout allele using oligonucleotide primer sequences TCCATCCAGTTGCCTTCTTGG (common), TTCTCATTTCCACGATTTCCCA (wild type reverse) and CGGAGAACCTGCGTGCAAT (mutant reverse). In some experiments, BXSB.B6Y consomic controls (BXSB.B6-Yaa+/MobJDcr) were used in which the Y chromosome from C57BL/6J was transferred onto BXSB, thereby replacing the BXSB Yaa chromosome. All mice used in the study were maintained under specific pathogen free conditions and were fed with standard feed and water ad libitum.

Ethics Statement

Animal Ethics Committees of NIAID, NIH and the Jackson Laboratory approved all experiments. The experiment procedures were in accordance with the guidelines of ASP LIG-16 approved by the Institutional Animal Care and Use Committee (IACUC) of NIAID and #01022 approved by The Jackson Laboratory Institutional Animal Care and Use Committee. BXSB.Yaa males and control animals were monitored daily for the development of enlarged lymph nodes. The animals were also monitored for splenomegaly by occasional palpitations. Once BXSB.Yaa mice were diagnosed with visible signs of disease, they were sacrificed immediately by CO2 asphyxiation along with age matched BXSB female controls.

Cell isolation and culture

Single cell suspensions were prepared from spleen, bone marrow (BM), lymph nodes and peritoneal washouts. Specific cell populations were isolated using standard protocols. CD43- B cells were isolated by CD43 (Ly-48) microbeads (Miltenyi) using the negative selection method. Splenic dendritic cells (DCs) were isolated using a mouse dendritic cell enrichment set (BD Biosciences) using the manufacturer’s protocol. BM-derived dendritic cells (BM-DCs) were generated by culturing BM cells (106/ml) with GM-CSF (40ng/ml) (Peprotech) and IL4 (20ng/ml) (Peprotech). Media were replenished with fresh cytokine-containing media on days 3, 7 and 9 of culture. Cells were harvested on day 11 and purity was determined by flow cytometry to be 94–95%. Peritoneal macrophages were obtained by adhering peritoneal washout cells to tissue culture plates for 4–5 hours. The non-adherent fraction was removed by repeated washing with sterile ice cold PBS and adherent cells were used for experiments. CD115+ monocytes were isolated by positive selection of CD115+ cells using a CD115 microbead kit (Miltenyi) following the manufacturer’s protocol. FcR blocking was performed using the 2.4G2 monoclonal antibody (BD Biosciences) as necessary.

Specific cell populations were cultured in the presence of the TLR7 agonist, Imiquimod (R837; Invivogen), for 24–48 hours in complete RPMI-1640 medium (Quality Biological) (RPMI-1640 medium supplemented with 10% FBS (Quality Biological, Lot#205C13), sodium pyruvate, non-essential amino acids, penicillin, streptomycin (all from Quality Biological) and 2-mercaptoethanol (GIBCO)). Cells or culture supernatants were harvested for further studies. In some experiments, B cells were cultured in the presence of anti-BCR antibody (2μg/ml; F(ab’)2 fragment goat anti-mouse IgM, μ chain specific; Jackson Immunoresearch), IFNα or IFNβ (20ng/ml; PBL Biomedical Laboratories).

Flow cytometry (FACS)

Standard multiparameter FACS analyses were performed using a BD LSRII instrument and antibodies listed in S1 Table. Data were collected using FACS Diva software and analyzed using FlowJo software (Tree Star). Doublet discrimination was performed and viable cells were gated using the propidium iodide exclusion method. B cell activation was assessed using surface expression of CD40, MHCII, ICOSL and CD86. Total splenic B cells were defined as B220+IgM+ cells and expression levels of IL21R and FAS were measured in terms of mean fluorescence intensity (MFI). Marginal zone B cells were defined as CD19+IgM+B220+CD5-CD23-CD21+, whereas follicular B cells were defined as CD19+IgM+B220+CD5-CD23hiCD21lo/-. Germinal center (GC) B cells were defined as B220+IgM+PNAhiFAS+GL7+ cells. TFH cells were defined as CD4+ICOShiCXCR5+PD1+ cells.

ELISA

(a) IL6 and IL21 ELISA. Culture supernatants (neat) or serum (1:20) were added to 96-well ELISA plates (Costar) coated with either purified anti-mouse-IL6 antibody (BD Biosciences) or anti-mouse IL21 antibody (Peprotech). IL6 or IL21 were captured by secondary biotinylated anti-mouse IL6 antibody (BD Biosciences) or anti-mouse IL21 antibody (Peprotech) followed by streptavidin-HRP/TMB (Sigma/Invitrogen) for colorimetric estimation. Washing with PBS-Tween-20 (0.5%) was followed at each step. Results were expressed as ng/ml of secreted IL6 or IL21 using two-fold serial dilutions of recombinant murine IL6 (BD Biosciences) or IL21 (Peprotech) as standards.

(b) Antibody isotype ELISA. Unlabeled purified anti-mouse IgG2b (BD Biosciences) and IgG2c (eBioscience) antibodies were coated on 96-well ELISA plates (Costar) in carbonate-bicarbonate buffer (pH = 9.6) overnight at 4°C. Plates were blocked with 2% IgG-free BSA (Jackson ImmunoResearch) for 2 hours at RT and serial dilutions of serum were added. Bound immunoglobulin isotypes were detected using biotin-labeled antibodies to IgG2b (BD Biosciences) and IgG2c (eBioscience) and color development was detected by streptavidin-HRP (Sigma) followed by TMB (Invitrogen). Reactions were stopped using 1N HCl and the OD was read at 450nm. At each step, plates were washed with PBS-Tween-20 (0.5%).

(c) Anti-nuclear antibody (ANA) or anti-dsDNA antibody (anti-DNA) ELISA. ANA and anti-dsDNA estimation was done using a mouse anti-nuclear Ab Total Ig kit and mouse anti-dsDNA Ab Total Ig kit (Alpha Diagnostics) following the manufacturer’s instructions. We used serum dilutions (1:100) on plates pre-coated with extractable nuclear antigens (ENA) for ANA quantitation (Alpha Diagnostics) or purified dsDNA (Alpha Diagnostics) for anti-dsDNA quantitation. Bound total Ig (IgG+IgM+IgA) was detected by HRP-labeled anti-mouse IgG+IgM+IgA (H+L) detection antibody (Alpha diagnostics) and colorimetric estimation was done using TMB substrate. Stop solution was added to terminate the reaction and color development was read at 450nm. All components in the assay were part of the specific kit used.

Cell proliferation assay

Negatively selected purified B cells were cultured in appropriate conditions in 96-well U-bottom plates (Costar) for 24h. 3H-thymidine (0.5 μCi/ well; Perkin Elmer) was added to the cultures and incubated for a further 16h. The cells were then harvested onto glass fiber filter mats (Perkin Elmer) using a Tomtec Harvester. Proliferation was measured as 3H- thymidine incorporation using a Perkin Elmer β-scintillation counter. Results were expressed as counts per minute (CPM).

Statistical analysis

All values in the figures are expressed as mean ± SEM of n observations (where n is indicated in the figure legends). Relevant data sets were compared by one or two way ANOVA, as deemed appropriate. All data were analyzed using the statistical tools of GraphPad Prism Software.

Results

BXSB.Yaa mice have increased serum levels of IL6 that correlate with humoral disease manifestations

To study possible contributions of IL6 to the BXSB.Yaa disease, we first compared levels of IL6 in sera from male BXSB.Yaa to levels for female BXSB mice, which develop a mild form of autoimmunity when older than 1 year [4, 5]. This comparison eliminated contributions of non-sex chromosome-linked lupus susceptibility genes while emphasizing potential effects of the Yaa-determined Tlr7 duplication. The results demonstrated that IL6 levels were significantly higher in sera of male Yaa compared to female mice, even at 1 month of age (Fig 1A). Levels peaked in sera from 3–4.5 month old male mice, the age at which disease symptoms start appearing, but then dropped in older mice. These age-related changes in serum IL6 levels correlated well with changes in serum levels of ANA and anti-dsDNA antibodies that were found at higher levels in male than female BXSB mice, again peaking at 3–4.5 months of age (Fig 1B).

thumbnail
Fig 1. IL6 levels correlate with disease manifestations in BXSB.Yaa mice.

Sera from BXSB.Yaa and BXSB mice of different ages were collected and tested for the levels of (A) IL6 (B) anti-nuclear antibodies (ANA) and anti-dsDNA antibodies, and (C) immunoglobulin isotypes (IgG2b and IgG2c); n = 4–20 mice per age group. Each dot represents one mouse. Horizontal bars represent mean ±SEM. p values are calculated by one-way ANOVA with Tukey’s multiple comparison tests. * p<0.05, ** p<0.01, ***p<0.0001.

https://doi.org/10.1371/journal.pone.0153059.g001

The fact that IL6 is known to augment plasma cell differentiation and immunoglobulin secretion led us to determine if age-related changes in IL6 expression would correlate with changes in serum immunoglobulin levels. Analyses of serum IgG2b showed that levels in male mice increased dramatically between 0.7–1.5 and 1.5–3 months of age and remained equally high thereafter (Fig 1C). Serum IgG2b levels of female mice also increased with age but were always substantially lower than for male BXSB.Yaa mice at each time point examined. These same patterns and relationships between sexes were also seen in analyses of serum IgG2c levels (Fig 1C). From these findings, we concluded that IL6 secretion correlates with the humoral progression of disease in BXSB.Yaa mice.

B cells are prominent producers of IL6

Previous studies in mice showed that B cells secrete IL6 in response to stimulation with TLR7 ligands [6, 25, 26]. In addition, it was shown that lymphoblastoid B cells isolated from lupus patients produced increased levels of IL6 [27]. To determine whether B cells from different hematopoietic compartments varied in their ability to produce IL6, we compared levels of IL6 secretion in culture supernatants of CD43- B cells purified from spleen, BM and peritoneal lavage from male and female BXSB mice. The cells were cultured for 24 hours with or without the TLR7 agonist, Imiquimod (R837). We found that B cells from BXSB.Yaa mice, regardless of source, secreted significantly higher levels of IL6 than cells from BXSB females when stimulated with R837 (Fig 2A). In addition, the levels of IL6 secreted by unstimulated or R837-stimulated peritoneal B cells were strikingly higher than those secreted by comparable populations of splenic or BM B cells (note differences in scale). It is known that IL6 is also produced by other APCs such as conventional splenic dendritic cells (cDCs), bone marrow derived dendritic cells (BM DCs), peritoneal resident macrophages and CD115+ monocytes. We next compared the levels of IL6 secreted by these cell subsets isolated from BXSB.Yaa and BXSB mice when stimulated with R837 in vitro. We found that IL6 levels secreted by each stimulated population were significantly higher in BXSB.Yaa compared with female BXSB control mice; however, these levels were markedly lower than those produced by any of the B cell populations studied (Fig 2B). This led us to conclude that IL6 secreted primarily by B cells in response to enhanced TLR7 expression as the result of Yaa is likely to be an important contributor to development of SLE-like disease in BXSB.Yaa mice.

thumbnail
Fig 2. B cells from BXSB.Yaa mice are potent producers of IL6.

(A) CD43- B cells were purified from spleen, BM and peritoneal lavage of 4–5 month old BXSB.Yaa and BXSB mice and stimulated with graded concentrations of Imiquimod (R837). (B) Dendritic cells enriched from spleen (splenic DCs) or differentiated from BM precursors (GMCSF (40ng/ml) and IL4 (20ng/ml) for 9 d with media changed every third day), peritoneal macrophages and CD115+ monocytes from spleens of BXSB.Yaa and BXSB mice were stimulated with R837 (50ng/ml) in vitro. Supernatants were collected after 24 hours and IL6 levels were quantified using a standard sandwich ELISA. Data expressed as mean ± SEM of triplicate wells are representative of 4–6 independent experiments. p values are determined by two-way ANOVA. * p<0.05, ** p<0.01, ***p<0.0001.

https://doi.org/10.1371/journal.pone.0153059.g002

BCR and TLR7 signaling pathways cooperate to induce IL6 secretion by B cells

The understanding that B cells are the primary producers of IL6 in BXSB.Yaa mice prompted us to determine whether their B cells are spontaneously activated. We found that the basal expression levels of activation markers for purified splenic B cells cultured in medium alone tended to be higher for cells from Yaa males compared with those from female BXSB mice, but reaching significance only for expression of MHCII (Fig 3A). These differences were greatly magnified after stimulation with R837 (Fig 3A). From this, we concluded that B cells from BXSB.Yaa mice are activated in the absence of overt stimulation and were substantially more responsive to activation by ligation of TLR7.

thumbnail
Fig 3. BXSB.Yaa B cells exhibit an activated phenotype.

(A) Purified CD43- B cells from 4–5 month old BXSB.Yaa and BXSB mice were stimulated with R837 (50ng/ml) for 24 hours and stained for surface expression of the activation markers—CD40, MHCII, ICOSL and CD86. Data are expressed as mean ± SEM of mean fluorescence intensity (MFI) and are pooled from 4–5 independent experiments. (B) Purified CD43- B cells from 4–5 month old BXSB.Yaa and BXSB mice were stimulated with graded doses of R837 for 24 hours. 3H thymidine (0.5μCi/well) was added and its incorporation was determined after 16 hours by liquid scintillation counting. Proliferation was determined as counts per minute (CPM). (C-D) CD43- B cells were stimulated with R837 (50ng/ml) in the presence and absence of anti-BCR antibody. IL6 secretion (C) and B cell proliferation (D) were determined as described earlier. (E) Purified B cells from 4–5 month old BXSB.Yaa and BXSB mice were cultured in the presence or absence of R837 (50ng/ml); IFNα and IFNβ (40U/ml), either alone or in combination, for 24h. Supernatants were collected and quantified for IL6 levels by standard sandwich ELISA. All data (B-E) are expressed as mean ± SEM of triplicate wells and are representative of 2–3 independent experiments. P values are determined by two-way ANOVA. * p<0.05, ** p<0.01, ***p<0.0001.

https://doi.org/10.1371/journal.pone.0153059.g003

Spontaneous activation of BXSB.Yaa cells may be attributed to the additional copy of Tlr7 that leads to B cell-mediated disease progression. Since TLR7 also promotes the proliferation, migration and terminal differentiation of murine B cells [28, 29], we further compared the proliferative responses of purified splenic B cells from male Yaa and female BXSB mice to R837 stimulation in vitro. B cells from both BXSB.Yaa and BXSB mice proliferated in a dose-dependent manner in response to TLR7 ligation, but the proliferative responses of B cells from males were always higher than those from cells from female mice (Fig 3B).

Previous studies have shown that co-stimulation through the BCR and TLR synergizes in activating B cells and that these activated B cells secrete elevated levels of IL6 [26, 29, 30]. To determine if B cell activation in BXSB.Yaa mice is a consequence of cooperative BCR and TLR signaling, we stimulated purified splenic B cells from male and female BXSB mice with R837 or the F(ab’)2 fragment of anti-IgM antibody (BCR), either alone or in combination. Supernatants of the cultures were assayed for IL6 levels (Fig 3C) and the cells were also assessed for proliferation (Fig 3D). We found that combined stimulation through TLR7 and the BCR synergistically augmented IL6 secretion by male and female B cells (Fig 3C). In addition, co-stimulation also enhanced the proliferative responses of both male and female B cells to these stimuli with the responses of male cells being significantly greater (Fig 3D). Collectively, these results indicated that B cells from BXSB.Yaa mice have a spontaneously activated phenotype, which is enhanced by co-engagement of the BCR and TLR7, a combination that also induced enhanced IL6 production and proliferation.

IFN1 enhances B cell activation driven by co-ligation of TLR7 and the BCR

Previous studies showed that IFN1 sensitizes B cells to activation by a number of stimuli [3133]. In addition, an “IFN signature”, marked by heightened expression of a series of IFN-stimulated genes, is associated with flares in human SLE [3436]. We recently found that purified B cells from T cell-deficient BXSB.Yaa mice as young as 4 weeks of age have a lupus-like “IFN signature” that develops in the absence of IL21. This signature is induced by expression of IFN1 by plasmacytoid DC (pDC) via a signaling pathway that is at least partially dependent on TLR7 (manuscript in preparation). To determine if IFN1 would affect the responsiveness of B cells from BXSB.Yaa mice, we cultured purified splenic B cells from both male and female BXSB mice in the presence or absence of R837, IFNα and IFNβ. We found that stimulation of B cells with IFN1 in the presence of a TLR7 ligand significantly enhanced B cell production of IL6 with male cells being significantly more responsive than female BXSB cells (Fig 3E). Moreover, additional stimulation through the BCR further stimulated IL6 secretion, indicating that signaling through the IFNAR, TLR7 and the BCR have a cooperative effect on IL6 production in BXSB.Yaa mice (S1 Fig). From this, we conclude that stimulation of B cells by both innate (IFN1, TLR7) and adaptive (BCR) signals collectively enhance IL6 secretion in BXSB.Yaa mice.

Abrogating IL6 signaling delays disease in BXSB.Yaa mice

To directly assess the importance of IL6 to the SLE-like disease of BXSB.Yaa mice, we generated BXSB.Yaa mice homozygous for a null allele of Il6 (BXSB.Yaa.Il6-/-) and studied them for disease development. First, we compared autoantibody levels in sera from 6–10 month old BXSB.Yaa.Il6-/-, BXSB.Yaa, and BXSB.B6Y consomic controls carrying a B6 Y chromosome as well as BXSB.Il6-/- females. We found that ANA levels in sera of IL6-deficient BXSB.Yaa mice were significantly lower than those of BXSB.Yaa mice and that they were comparable to those of female BXSB mice and BXSB.B6Y consomic controls. (Fig 4A). This observation suggested that IL6 signaling is a major contributor to the development of autoantibodies. To further address this issue, we compared the survival and disease characteristics of BXSB.Yaa.Il6-/-, BXSB.Yaa.Il6+/- and BXSB.Yaa mice. We found that the survival of BXSB.Yaa.Il6-/- mice was significantly prolonged compared to that of BXSB.Yaa and BXSB.Yaa.Il6+/- mice (Fig 4B). Further studies demonstrated that spleen weights (Fig 4C) and serum levels of IgG2b and IgG1 (Fig 4D) were significantly lower in BXSB.Yaa.Il6-/- than BXSB.Yaa.Il6+/- mice. In addition, serum levels of anti-dsDNA antibodies were significantly lower in sera of BXSB.Yaa.Il6-/- than BXSB.Yaa mice and were comparable to levels in sera of BXSB.B6Y consomic controls and normal B6 mice (Fig 4E).

thumbnail
Fig 4. IL6-deficient BXSB.Yaa mice have reduced disease manifestations.

(A) Sera from 6-month old BXSB.Yaa.Il6-/-, BXSB.Yaa, BXSB.Il6-/-, BXSB, BXSB.B6Y and C57BL/6 mice were quantified for the presence of ANA by ELISA (n = 3–10 mice per group). Each dot represents one mouse. Horizontal bars indicate mean ± SEM and p values are calculated by one-way ANOVA with Tukey’s multiple comparison tests. (B) Survival curve analysis of BXSB.Yaa.Il6+/- (n = 17), BXSB.Yaa.Il6-/—(n = 41) and archival data of BXSB.Yaa (n = 93) mice. (C-E) IL6-competent and—deficient BXSB.Yaa mice (n = 8–10) were compared for disease manifestations including spleen weight (C), serum IgG1 and IgG2b (D) and serum anti-dsDNA antibody titers (E). Bars represent mean ± SEM of observations from individual mice and p values are calculated using two-way ANOVA. * p<0.05, ** p<0.01, ***p<0.0001.

https://doi.org/10.1371/journal.pone.0153059.g004

To determine if the cellular effects of IL6 deficiency can be detected in young mice, we first characterized cells in the blood of 6 week old BXSB.Yaa.Il6-/- and BXSB.Yaa.Il6+/- mice. FACS analyses of different activation markers revealed that levels of expression of MHCII, IL21R and FAS were lower on B cells of BXSB.Yaa.Il6-/- than BXSB.Yaa mice (Fig 5A). Interestingly, in studies of spleens, the frequencies of total B220+IgM+ B cells were equivalent for BXSB.Yaa.Il6-/-, BXSB.Yaa and BXSB.B6Y mice (Fig 5B, left panel and data not shown). In contrast, the frequencies of splenic GC B cells and levels of FAS expression on B cells were significantly lower for BXSB.Yaa.Il6-/- than BXSB.Yaa.Il6+/- mice (Fig 5B and S2 Fig). These data clearly indicated that the effects of IL6 deficiency could be detected early in the life of BXSB.Yaa mice, consistent with an important role in disease initiation.

thumbnail
Fig 5. Early activation of B cells in BXSB.Yaa mice is reduced in the absence of IL6.

6–7.5 weeks old BXSB.Yaa (n = 5) and BXSB.Yaa.Il6-/- (n = 8) mice were bled and (A) cells were stained with fluorescent-labeled antibodies to B220, IgM, MHCII, IL21R and FAS and analyzed by FACS. Expression of MHCII, IL21R and FAS on viable single cells gated on B220+IgM+ is determined as MFI. (B) The frequencies of splenic total B cells (B220+IgM+) and GC B cells (B220+IgM+PNAhiFAS+GL7+) were determined and expressed as percentages of total cells. Expression levels of FAS on GC B cells are depicted as mean fluorescence intensity (MFI). Data are expressed as mean ± SEM of individual values obtained from each mouse and statistical analysis is done using two tailed unpaired t test. * p<0.05, ** p<0.01, ***p<0.0001.

https://doi.org/10.1371/journal.pone.0153059.g005

Earlier studies showed that BXSB.Yaa mice have reduced frequencies of marginal zone B cells [37] caused, at least in part, by high levels of IL21 expression [9]. We observed that in the absence of IL6 signaling, the frequencies of marginal zone B cells were increased in BXSB.Yaa Il6-/- compared with BXSB.Yaa mice, though not significantly. However, the increased frequencies of marginal zone B cells were not comparable to the frequencies seen with consomic BXSB.B6Y controls suggesting that enhanced expression of IL6 in addition to IL21 contributes to the reduction in the marginal zone B cell compartment of BXSB.Yaa mice (S3A and S3B Fig). Since activated monocytes and granulocytes are some of the other known disease manifestations of BXSB.Yaa mice [3840], we asked whether ablation of IL6 signaling had a significant impact on these cell populations. We found that both CD11b+ and Gr-1+ cells had significantly lower expression of MHCII in BXSB.Yaa.Il6-/- mice as compared to BXSB.Yaa mice (S3C Fig) suggesting that ablation of IL6 signaling reduced levels of activated monocytes and granulocytes in BXSB.Yaa mice.

Taken together, these data support our suggestion that interruption of IL6 signaling has a significant impact on disease development from early in life that ultimately results in increased survival of BXSB.Yaa mice.

IL6 acts upstream of IL21 in disease progression caused by Yaa

We previously reported that IL21, the signature cytokine secreted by CD4+ T follicular helper (TFH) cells, is a critical determinant of the disease of BXSB.Yaa mice [911]. Previous studies reported that IL6 promotes the secretion of IL21 and that optimal TFH differentiation is mediated by both IL6 and IL21 [15, 41]. In addition, our observation that BXSB.Yaa mice have expanded populations of TFH prompted us to examine whether ablation of IL6 would affect the expansions of TFH cells. We found, first, that the frequencies of total CD4+ T cells were significantly reduced in spleens of IL6-deficient BXSB.Yaa mice as compared to normal BXSB.Yaa mice (Fig 6A, left panel, S4A Fig). Second, IL6 deficiency impacted the frequencies of TFH by 6 weeks of age as evidenced by the significant reduction in the frequencies of PD1+CD4+ T cells in spleens of IL6-deficient BXSB.Yaa mice (Fig 6A, right panel, S4B Fig) as compared to BXSB.Yaa mice or consomic BXSB.B6Y controls. To ascertain whether the reduction in CD4+ TFH cell numbers required the autosomal SLE predisposition background of BXSB, we determined the effects of an IL6 deficiency in B6.Yaa mice, which develop a late onset autoimmune disease due to Yaa. We found that B6.Yaa Il6-/- mice analyzed at 40 weeks of age had reduced frequencies of CD4+ TFH cells (S5A and S5B Fig) as evidenced by the reduced expression of ICOS and PD1 on CD4+ T cells of B6.YaaIl6-/- mice when compared with age matched WT controls (S5C and S5D Fig). Finally, we quantified serum IL21 levels in IL6-deficient BXSB.Yaa mice from 6 weeks to 5 months of age and found that the levels were significant decreased at both time points (Fig 6B). This indicates that IL6 acts upstream of IL21 in the early phase of BXSB.Yaa disease by limiting the development of TFH which are the primary source of IL21. From this we concluded that IL6 acts to promote and maintain the development of TFH that are the primary source of IL21 required for the SLE-like manifestations caused by the Yaa mutation.

thumbnail
Fig 6. IL6 deficiency reduces the TFH population in BXSB.Yaa mice.

(A) Splenocytes from BXSB.Yaa.Il6-/- (n = 8) BXSB.Yaa (n = 5), BXSB.B6Y (n = 6) and C57BL/6J (n = 3) mice aged 6–9 weeks were stained with labeled antibodies to CD4, ICOS and PD1. Percentages of CD4+ T cells (CD4+) and TFH cells (CD4+ICOShiPD1+) cells were determined by FACS and expressed as mean ± SEM. (B) Sera from BXSB.Yaa.Il6-/- (n = 12; 1.5–5 months old), BXSB.Il6-/- (n = 5; 3–5 months old); BXSB.Yaa (n = 5; 3–5 months old) and BXSB (n = 5; 3–5 months old) mice were quantified for IL21 by sandwich ELISA. Data is expressed as mean ± SEM from observations from each mouse. Statistical analysis was done using one-way ANOVA with Tukey’s multiple comparison test. * p<0.05, ** p<0.01, ***p<0.0001.

https://doi.org/10.1371/journal.pone.0153059.g006

Discussion

IL6 is a pleiotropic proinflammatory cytokine that normally induces terminal differentiation of B cells into plasma cells and memory B cells. IL6 also affects T cells by transcriptionally activating naïve CD4+ T cells to become TFH [42]. However, heightened expression of IL6 has also been associated with a range of pathologies including a variety of autoimmune diseases in humans and mice. A close association between expression of IL6 and progression of lupus-like diseases has been described for several mouse models of SLE. Studies of autoimmune MRL.Faslpr mice showed that serum levels of IL6 and the IL6 receptor (IL6R) increased in an age-dependent manner [1820]. Treatment with an IL6 neutralizing antibody led to reduced production of autoantibodies in old (NZB x NZW)F1 mice [43]. In the pristane-induced model of SLE, production of autoantibodies was abrogated in mice deficient in IL6 [44]. Conversely, treatment of (NZB x NZW)F1 mice with IL6 accelerated disease progression [45]. Finally, several studies of human SLE have suggested a prominent role for IL6 in B cell hyperactivity and immunopathology in that elevated serum levels of IL6 were associated with disease activity or levels of autoantibodies [21, 22]. It was also reported that B cells from patients with SLE spontaneously produced high levels of IL6 and expressed the IL6R [46, 47].

It is known that IL6 production by both human and murine B cells is enhanced following cooperative signaling through TLR7 and CD40 [26]. Moreover, autoreactive B cells can be activated by simultaneous ligation of TLR7 and the BCR [48]. TLR7 recognizes ssRNA and signals through MyD88 resulting in the activation of B cells in an NF-κB-dependent manner [49]. TLR7 is also considered to be an important contributor to the development of human lupus [5053]. The recombinant inbred mouse, BXSB.Yaa, develops an accelerated SLE-like disease due to the translocation of a telomeric region of the X chromosome to the Y chromosome, resulting in the duplication of at least 16 genes including Tlr7 in male mice [2, 3]. The duplication of Tlr7 has been shown to be primarily determinant responsible for the disease of BXSB.Yaa mice. Tlr7 is widely considered to be the genetic driver of overt SLE-like disease in the presence of other lupus susceptibility alleles in mice and genome wide association studies identified TLR7 as a risk factor for SLE in humans [5053].

The present study was designed to address the extent to which IL6 contributes to the autoimmune disease caused by Yaa in BXSB mice and its cellular sources. We clearly established that BXSB.Yaa mice have elevated serum levels of IL6 in association with increasing disease manifestations of hypergammaglobulinemia and levels of ANA in an age-dependent manner. These findings are strongly supported by our results showing that IL6-deficient BXSB.Yaa mice had greatly reduced levels of class-switched immunoglobulins and autoantibodies and lived significantly longer. Further, Yaa causes B cells in these mice to become activated, highly responsive to TLR7, BCR and TLR7 + BCR stimulation, and to secrete high levels of IL6, all of which is consistent with B cells being the primary source of IL6 that promotes BXSB.Yaa disease. In addition, B cells also express type I interferon receptors (IFNAR). IFN1 has been shown to sensitize B cells to be more responsive to BCR signals, enhance their proliferation and survival and to augment antibody responses while promoting isotype switching [5456]. Our results indicate that BXSB.Yaa B cells secrete large amounts of IL6 when stimulated simultaneously through IFNAR, TLR7 and the BCR suggesting that IL6 is critical to development of disease at a very early stage.

Our previous studies established that IL21-IL21R signaling to B cells resulting in expanded populations of CD4+ TFH is a critical factor in driving disease in these mice, while IL21-IL21R signaling to CD8+ T and NK cells restricts disease progression [911]. Thus, the development of TFH that secrete high levels of IL21 is a central component of the BXSB.Yaa disease. Here we found that the frequency of CD4+ TFH cells and the serum levels of IL21 were significantly decreased in IL6-deficient BXSB.Yaa mice. Moreover, the involvement of IL6 in supporting the expansion of TFH was evident in BXSB.Yaa mice at early age mice. IL6 has been shown to be an important factor in the activation of BCL6, which is the critical transcription factor in the differentiation of naïve CD4+ T cells to TFH [14, 15]. IL6 has been shown to support TFH differentiation even at their earliest stages of lineage commitment [42, 57, 58]. The abundance of IL6 secreted mainly by activated B cells in a TLR7-dependent manner suggests that they are the major source of IL6 that drives the expansion of IL21-producing TFH in BXSB.Yaa mice.

Taken together, the results of this study define an important role for IL6 in the development and progression of the SLE-like disease of BXSB.Yaa mice, suggesting that IL6 signaling could provide an important point for therapeutic intervention. A human open-label phase I trial in SLE patients of Tocilizumab, a monoclonal antibody that inhibits binding of IL6 to its receptor, revealed improvements in disease activity and reduced levels of serum autoantibodies [59]. However, the patients also experienced an increased number of infections suggesting that changes in the protocol or adoption of new approaches to blocking IL6 signaling were in order. In another double blind phase II trial, SLE patients treated intravenously with Sirukumab, a fully human anti-IL6 monoclonal antibody, suffered from some minor respiratory infections [60]. If direct interference with IL6-IL6R signaling is not possible due to adverse effects, several JAK inhibitors such as Tofacitinib and Ruxolitinib that prevent downstream signaling from the IL6R may be worth investigating for therapeutic purposes. Since IL6 production is enhanced by co-stimulation through TLR7 and the BCR, other therapeutic interventions could include inhibitors of TLR7, IRF7 and STAT activity.

Supporting Information

S1 Fig. Concomitant signaling through TLR, BCR and type I interferon enhances IL6 secretion by BXSB.Yaa B cells.

Purified B cells from BXSB.Yaa and BXSB mice were cultured in the presence or absence of R837 (50ng/ml); anti-BCR antibody (2g/ml); IFN and (40U/ml), either alone or in combinations, for 24h. Supernatants were collected and quantified for IL6 levels by standard sandwich ELISA method. Data is expressed as mean ± SEM of triplicate wells and is representative of two independent experiments.

https://doi.org/10.1371/journal.pone.0153059.s001

(TIF)

S2 Fig. Gating strategy for germinal center B cells.

Splenocytes from BXSB.Yaa, BXSB.Yaa and BXSB mice were isolated and stained with anti-mouse antibodies to identify germinal center B cells (B220+GL7+Fas+).

https://doi.org/10.1371/journal.pone.0153059.s002

(TIF)

S3 Fig. Abrogating IL6 signaling diminishes marginal zone B cell frequencies and activation of monocytes.

Splenocytes from BXSB.Yaa.Il6-/-, BXSB.Yaa and consomic BXSB.B6Y mice were isolated and stained with anti-mouse antibodies to determine (A-B) marginal zone B cells (CD19+IgM+B220+CD5-CD23-CD21+) and (B) MHCII expression on CD11b+ and Gr-1+ cells.

https://doi.org/10.1371/journal.pone.0153059.s003

(TIF)

S4 Fig. Gating strategy for CD4 TFH cells.

Splenocytes from B6.Yaa.Il6-/- and B6.Yaa Il6+/- mice were isolated and stained with anti-mouse antibodies to determine (A) CD4TFH cells (PD1+ ICOShi CD4+) and (B) PD1+ CD4+ cells.

https://doi.org/10.1371/journal.pone.0153059.s004

(TIF)

S5 Fig. IL6 acts upstream of IL21 in the disease progression of BXSB.Yaa mice.

Splenocytes from B6.Yaa.Il6-/- and B6.Yaa Il6+/- mice were isolated and stained with anti-mouse antibodies. (A) FACS plots determine ICOS vs PD-1 expression on CD4+ T cells. Numbers in the plots represent percentage of total cells. Bar diagrams represent (B) percentages of CD4+ T cells (C) percentages of CD4TFH (PD1+ ICOS+ CD4+) cells (D) ICOS and PD-1 expression (MFI) on CD4 T cells. (B) and (C) represent frequencies of parent population. Data is mean ± SEM of 7–8 mice per group. P values were determined by two way ANOVA.

https://doi.org/10.1371/journal.pone.0153059.s005

(TIF)

S1 Table. List of Antibodies used in FACS and ELISA.

https://doi.org/10.1371/journal.pone.0153059.s006

(DOCX)

Acknowledgments

This work was supported in part by the Intramural Research Program of the NIH, National Institute of Allergy and Infectious Diseases (NIAID), and by the Alliance for Lupus Research.

Author Contributions

Conceived and designed the experiments: SJ HCM DCR. Performed the experiments: SJ GP TJS GJC CML HW. Analyzed the data: SJ GP TJS HW CML. Contributed reagents/materials/analysis tools: TJS DCR HCM. Wrote the paper: SJ HW DCR HCM.

References

  1. 1. Cui Y, Sheng Y, Zhang X. Genetic susceptibility to SLE: recent progress from GWAS. Journal of autoimmunity. 2013;41:25–33. pmid:23395425.
  2. 2. Pisitkun P, Deane JA, Difilippantonio MJ, Tarasenko T, Satterthwaite AB, Bolland S. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science. 2006;312(5780):1669–72. pmid:16709748.
  3. 3. Subramanian S, Tus K, Li QZ, Wang A, Tian XH, Zhou J, et al. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(26):9970–5. pmid:16777955; PubMed Central PMCID: PMC1502563.
  4. 4. Murphy ED, Roths JB. A Y chromosome associated factor in strain BXSB producing accelerated autoimmunity and lymphoproliferation. Arthritis and rheumatism. 1979;22(11):1188–94. pmid:315777.
  5. 5. Murphy ED, Roths JB. The genetic control of autoimmune disease. In: Rose NR, Bigazzi PE, Warner NL, editors. New York: Elsevier/Holland; 1978. p. 207–21.
  6. 6. Bishop GA, Ramirez LM, Baccam M, Busch LK, Pederson LK, Tomai MA. The immune response modifier resiquimod mimics CD40-induced B cell activation. Cellular immunology. 2001;208(1):9–17. pmid:11277614.
  7. 7. Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, et al. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nature immunology. 2002;3(2):196–200. pmid:11812998.
  8. 8. Honda K, Ohba Y, Yanai H, Negishi H, Mizutani T, Takaoka A, et al. Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature. 2005;434(7036):1035–40. pmid:15815647.
  9. 9. Bubier JA, Sproule TJ, Foreman O, Spolski R, Shaffer DJ, Morse HC 3rd, et al. A critical role for IL-21 receptor signaling in the pathogenesis of systemic lupus erythematosus in BXSB-Yaa mice. Proceedings of the National Academy of Sciences of the United States of America. 2009;106(5):1518–23. pmid:19164519; PubMed Central PMCID: PMC2635818.
  10. 10. McPhee CG, Sproule TJ, Shin DM, Bubier JA, Schott WH, Steinbuck MP, et al. MHC class I family proteins retard systemic lupus erythematosus autoimmunity and B cell lymphomagenesis. Journal of immunology. 2011;187(9):4695–704. pmid:21964024; PubMed Central PMCID: PMC3381364.
  11. 11. McPhee CG, Bubier JA, Sproule TJ, Park G, Steinbuck MP, Schott WH, et al. IL-21 is a double-edged sword in the systemic lupus erythematosus-like disease of BXSB.Yaa mice. Journal of immunology. 2013;191(9):4581–8. pmid:24078696; PubMed Central PMCID: PMC3807747.
  12. 12. Dienz O, Eaton SM, Bond JP, Neveu W, Moquin D, Noubade R, et al. The induction of antibody production by IL-6 is indirectly mediated by IL-21 produced by CD4+ T cells. The Journal of experimental medicine. 2009;206(1):69–78. pmid:19139170; PubMed Central PMCID: PMC2626667.
  13. 13. Diehl SA, Schmidlin H, Nagasawa M, Blom B, Spits H. IL-6 triggers IL-21 production by human CD4+ T cells to drive STAT3-dependent plasma cell differentiation in B cells. Immunology and cell biology. 2012;90(8):802–11. pmid:22491065; PubMed Central PMCID: PMC3396759.
  14. 14. Eddahri F, Denanglaire S, Bureau F, Spolski R, Leonard WJ, Leo O, et al. Interleukin-6/STAT3 signaling regulates the ability of naive T cells to acquire B-cell help capacities. Blood. 2009;113(11):2426–33. pmid:19020307; PubMed Central PMCID: PMC2656270.
  15. 15. Eto D, Lao C, DiToro D, Barnett B, Escobar TC, Kageyama R, et al. IL-21 and IL-6 are critical for different aspects of B cell immunity and redundantly induce optimal follicular helper CD4 T cell (Tfh) differentiation. PloS one. 2011;6(3):e17739. pmid:21423809; PubMed Central PMCID: PMC3056724.
  16. 16. Poholek AC, Hansen K, Hernandez SG, Eto D, Chandele A, Weinstein JS, et al. In vivo regulation of Bcl6 and T follicular helper cell development. Journal of immunology. 2010;185(1):313–26. pmid:20519643; PubMed Central PMCID: PMC2891136.
  17. 17. Choi YS, Eto D, Yang JA, Lao C, Crotty S. Cutting edge: STAT1 is required for IL-6-mediated Bcl6 induction for early follicular helper cell differentiation. Journal of immunology. 2013;190(7):3049–53. pmid:23447690; PubMed Central PMCID: PMC3626564.
  18. 18. Tang B, Matsuda T, Akira S, Nagata N, Ikehara S, Hirano T, et al. Age-associated increase in interleukin 6 in MRL/lpr mice. International immunology. 1991;3(3):273–8. pmid:2049341.
  19. 19. Kobayashi I, Matsuda T, Saito T, Yasukawa K, Kikutani H, Hirano T, et al. Abnormal distribution of IL-6 receptor in aged MRL/lpr mice: elevated expression on B cells and absence on CD4+ cells. International immunology. 1992;4(12):1407–12. pmid:1363056.
  20. 20. Suzuki H, Yasukawa K, Saito T, Narazaki M, Hasegawa A, Taga T, et al. Serum soluble interleukin-6 receptor in MRL/lpr mice is elevated with age and mediates the interleukin-6 signal. European journal of immunology. 1993;23(5):1078–82. pmid:8477802.
  21. 21. Grondal G, Gunnarsson I, Ronnelid J, Rogberg S, Klareskog L, Lundberg I. Cytokine production, serum levels and disease activity in systemic lupus erythematosus. Clinical and experimental rheumatology. 2000;18(5):565–70. pmid:11072595.
  22. 22. Linker-Israeli M, Deans RJ, Wallace DJ, Prehn J, Ozeri-Chen T, Klinenberg JR. Elevated levels of endogenous IL-6 in systemic lupus erythematosus. A putative role in pathogenesis. Journal of immunology. 1991;147(1):117–23. pmid:2051017.
  23. 23. Mihara M, Ohsugi Y. Possible role of IL-6 in pathogenesis of immune complex-mediated glomerulonephritis in NZB/W F1 mice: induction of IgG class anti-DNA autoantibody production. International archives of allergy and applied immunology. 1990;93(1):89–92. pmid:2086490.
  24. 24. Yang Z, Liang Y, Qin B, Zhong R. A meta-analysis of the association of IL-6–174 G/C and -572 G/C polymorphisms with systemic lupus erythematosus risk. Rheumatology international. 2014;34(2):199–205. pmid:24013670.
  25. 25. Glaum MC, Narula S, Song D, Zheng Y, Anderson AL, Pletcher CH, et al. Toll-like receptor 7-induced naive human B-cell differentiation and immunoglobulin production. The Journal of allergy and clinical immunology. 2009;123(1):224–30 e4. pmid:18995892.
  26. 26. Vanden Bush TJ, Bishop GA. TLR7 and CD40 cooperate in IL-6 production via enhanced JNK and AP-1 activation. European journal of immunology. 2008;38(2):400–9. pmid:18228247; PubMed Central PMCID: PMC2951126.
  27. 27. Klashman DJ, Martin RA, Martinez-Maza O, Stevens RH. In vitro regulation of B cell differentiation by interleukin-6 and soluble CD23 in systemic lupus erythematosus B cell subpopulations and antigen-induced normal B cells. Arthritis and rheumatism. 1991;34(3):276–86. pmid:1825912.
  28. 28. Bekeredjian-Ding I, Jego G. Toll-like receptors—sentries in the B-cell response. Immunology. 2009;128(3):311–23. pmid:20067531; PubMed Central PMCID: PMC2770679.
  29. 29. Genestier L, Taillardet M, Mondiere P, Gheit H, Bella C, Defrance T. TLR agonists selectively promote terminal plasma cell differentiation of B cell subsets specialized in thymus-independent responses. Journal of immunology. 2007;178(12):7779–86. pmid:17548615.
  30. 30. Leadbetter EA, Rifkin IR, Hohlbaum AM, Beaudette BC, Shlomchik MJ, Marshak-Rothstein A. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature. 2002;416(6881):603–7. pmid:11948342.
  31. 31. Coro ES, Chang WL, Baumgarth N. Type I IFN receptor signals directly stimulate local B cells early following influenza virus infection. Journal of immunology. 2006;176(7):4343–51. pmid:16547272.
  32. 32. Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM, et al. Functional role of type I and type II interferons in antiviral defense. Science. 1994;264(5167):1918–21. pmid:8009221.
  33. 33. Rau FC, Dieter J, Luo Z, Priest SO, Baumgarth N. B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. Journal of immunology. 2009;183(12):7661–71. pmid:19933871; PubMed Central PMCID: PMC2795108.
  34. 34. Crow MK, Kirou KA, Wohlgemuth J. Microarray analysis of interferon-regulated genes in SLE. Autoimmunity. 2003;36(8):481–90. pmid:14984025.
  35. 35. Baechler EC, Batliwalla FM, Karypis G, Gaffney PM, Ortmann WA, Espe KJ, et al. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proceedings of the National Academy of Sciences of the United States of America. 2003;100(5):2610–5. pmid:12604793; PubMed Central PMCID: PMC151388.
  36. 36. Ronnblom L, Alm GV, Eloranta ML. The type I interferon system in the development of lupus. Seminars in immunology. 2011;23(2):113–21. pmid:21292501.
  37. 37. Amano H, Amano E, Moll T, Marinkovic D, Ibnou-Zekri N, Martinez-Soria E, et al. The Yaa mutation promoting murine lupus causes defective development of marginal zone B cells. Journal of immunology. 2003;170(5):2293–301. pmid:12594250.
  38. 38. Wofsy D, Kerger CE, Seaman WE. Monocytosis in the BXSB model for systemic lupus erythematosus. The Journal of experimental medicine. 1984;159(2):629–34. pmid:6363600; PubMed Central PMCID: PMC2187231.
  39. 39. Rogers NJ, Gabriel L, Nunes CT, Rose SJ, Thiruudaian V, Boyle J, et al. Monocytosis in BXSB mice is due to epistasis between Yaa and the telomeric region of chromosome 1 but does not drive the disease process. Genes and immunity. 2007;8(8):619–27. pmid:17728791.
  40. 40. Kofler R, McConahey PJ, Duchosal MA, Balderas RS, Theofilopoulos AN, Dixon FJ. An autosomal recessive gene that delays expression of lupus in BXSB mice. Journal of immunology. 1991;146(4):1375–9. pmid:1991974.
  41. 41. Suto A, Kashiwakuma D, Kagami S, Hirose K, Watanabe N, Yokote K, et al. Development and characterization of IL-21-producing CD4+ T cells. The Journal of experimental medicine. 2008;205(6):1369–79. pmid:18474630; PubMed Central PMCID: PMC2413034.
  42. 42. Crotty S. Follicular helper CD4 T cells (TFH). Annual review of immunology. 2011;29:621–63. pmid:21314428.
  43. 43. Alarcon-Riquelme ME, Moller G, Fernandez C. Macrophage depletion decreases IgG anti-DNA in cultures from (NZB x NZW)F1 spleen cells by eliminating the main source of IL-6. Clinical and experimental immunology. 1993;91(2):220–5. pmid:8428389; PubMed Central PMCID: PMC1554691.
  44. 44. Richards HB, Satoh M, Shaw M, Libert C, Poli V, Reeves WH. Interleukin 6 dependence of anti-DNA antibody production: evidence for two pathways of autoantibody formation in pristane-induced lupus. The Journal of experimental medicine. 1998;188(5):985–90. pmid:9730900; PubMed Central PMCID: PMC2213386.
  45. 45. Finck BK, Chan B, Wofsy D. Interleukin 6 promotes murine lupus in NZB/NZW F1 mice. The Journal of clinical investigation. 1994;94(2):585–91. pmid:8040314; PubMed Central PMCID: PMC296134.
  46. 46. Kitani A, Hara M, Hirose T, Norioka K, Harigai M, Hirose W, et al. Heterogeneity of B cell responsiveness to interleukin 4, interleukin 6 and low molecular weight B cell growth factor in discrete stages of B cell activation in patients with systemic lupus erythematosus. Clinical and experimental immunology. 1989;77(1):31–6. pmid:2788539; PubMed Central PMCID: PMC1541934.
  47. 47. Nagafuchi H, Suzuki N, Mizushima Y, Sakane T. Constitutive expression of IL-6 receptors and their role in the excessive B cell function in patients with systemic lupus erythematosus. Journal of immunology. 1993;151(11):6525–34. pmid:8245483.
  48. 48. Lau CM, Broughton C, Tabor AS, Akira S, Flavell RA, Mamula MJ, et al. RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. The Journal of experimental medicine. 2005;202(9):1171–7. pmid:16260486; PubMed Central PMCID: PMC2213226.
  49. 49. von Landenberg P, Bauer S. Nucleic acid recognizing Toll-like receptors and autoimmunity. Current opinion in immunology. 2007;19(6):606–10. pmid:18060756.
  50. 50. Deane JA, Pisitkun P, Barrett RS, Feigenbaum L, Town T, Ward JM, et al. Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity. 2007;27(5):801–10. pmid:17997333; PubMed Central PMCID: PMC2706502.
  51. 51. Fairhurst AM, Hwang SH, Wang A, Tian XH, Boudreaux C, Zhou XJ, et al. Yaa autoimmune phenotypes are conferred by overexpression of TLR7. European journal of immunology. 2008;38(7):1971–8. pmid:18521959; PubMed Central PMCID: PMC2993003.
  52. 52. Santiago-Raber ML, Kikuchi S, Borel P, Uematsu S, Akira S, Kotzin BL, et al. Evidence for genes in addition to Tlr7 in the Yaa translocation linked with acceleration of systemic lupus erythematosus. Journal of immunology. 2008;181(2):1556–62. pmid:18606711.
  53. 53. Shen N, Fu Q, Deng Y, Qian X, Zhao J, Kaufman KM, et al. Sex-specific association of X-linked Toll-like receptor 7 (TLR7) with male systemic lupus erythematosus. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(36):15838–43. pmid:20733074; PubMed Central PMCID: PMC2936646.
  54. 54. Braun D, Caramalho I, Demengeot J. IFN-alpha/beta enhances BCR-dependent B cell responses. International immunology. 2002;14(4):411–9. pmid:11934877.
  55. 55. Le Bon A, Schiavoni G, D'Agostino G, Gresser I, Belardelli F, Tough DF. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity. 2001;14(4):461–70. pmid:11336691.
  56. 56. Santiago-Raber ML, Baccala R, Haraldsson KM, Choubey D, Stewart TA, Kono DH, et al. Type-I interferon receptor deficiency reduces lupus-like disease in NZB mice. The Journal of experimental medicine. 2003;197(6):777–88. pmid:12642605; PubMed Central PMCID: PMC2193854.
  57. 57. Nurieva RI, Chung Y, Martinez GJ, Yang XO, Tanaka S, Matskevitch TD, et al. Bcl6 mediates the development of T follicular helper cells. Science. 2009;325(5943):1001–5. pmid:19628815; PubMed Central PMCID: PMC2857334.
  58. 58. Ma CS, Suryani S, Avery DT, Chan A, Nanan R, Santner-Nanan B, et al. Early commitment of naive human CD4(+) T cells to the T follicular helper (T(FH)) cell lineage is induced by IL-12. Immunology and cell biology. 2009;87(8):590–600. pmid:19721453.
  59. 59. Illei GG, Shirota Y, Yarboro CH, Daruwalla J, Tackey E, Takada K, et al. Tocilizumab in systemic lupus erythematosus: data on safety, preliminary efficacy, and impact on circulating plasma cells from an open-label phase I dosage-escalation study. Arthritis and rheumatism. 2010;62(2):542–52. pmid:20112381; PubMed Central PMCID: PMC3057537.
  60. 60. Szepietowski JC, Nilganuwong S, Wozniacka A, Kuhn A, Nyberg F, van Vollenhoven RF, et al. Phase I, randomized, double-blind, placebo-controlled, multiple intravenous, dose-ascending study of sirukumab in cutaneous or systemic lupus erythematosus. Arthritis and rheumatism. 2013;65(10):2661–71. pmid:23896980.